pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
(Plasmid
#138985)
-
PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 5357
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCRA
-
Alt namemurderous crow alpha
-
Alt name31_TRA_CAASEEDSNYQLIW_TGTGCTGCAAGTGAGGAGGATAGCAACTATCAGTTGATCTGG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)830
-
Entrez GeneTcra (a.k.a. Tcralpha)
- Promoter CMV and T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer BGH-rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.11.30.470597v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow was a gift from Jeff Hammerbacher (Addgene plasmid # 138985 ; http://n2t.net/addgene:138985 ; RRID:Addgene_138985) -
For your References section:
Discovering tumor-reactive T-cell receptors through single-cell sequencing of tumor-infiltrating lymphocytes. Gottschalk E, Aksoy BA, Aksoy P, Swiderska-syn M, Mart C, Macpherson L, Romeo M, Smith A, Knochelmann H, Paulos C, Timmers C, Wrangle J, Rubinstein MP, Hammerbacher J. bioRxiv 2021.11.30.470597 10.1101/2021.11.30.470597