pShuttle-CMV-EGFP-C
(Plasmid #13887)

• Depositing Lab: Lorene Lanier
• Publication: Strasser et al Neuron. 2004 Jul 8. 43(1):81-94.

Backbone

• Vector backbone: pShuttle-CMV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 7500
• Vector type: Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: C domain of N-WASP
• Alt name: EGFP-C
• Alt name: WASL
• Species: B. taurus (bovine)
• Insert Size (bp): 789
• Mutation: The BglII site in the MCS of pShuttle-CMV was filled and the vector was religated in order to remove this BglII site.
• GenBank ID: NM_174219
• Entrez Gene: WASL (a.k.a. BOS_4408)
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: HinDIII (not destroyed)
• 5′ sequencing primer: GGCACCAAAATCAACGGGACTTTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original full length N-WASP gene clone was given to me by Dr. Laura Machesky School of Biosciences The University of Birmingham Edgbaston Birmingham B15 2TT UK

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry