Skip to main content
Addgene

pPD341 FKBP-ZF43 (NLS)
(Plasmid #138844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138844 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD005 pcDNA Golden Gate
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP-ZF43
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFlag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Leonard Lab plasmid reference number: L1349

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPD341 FKBP-ZF43 (NLS) was a gift from Joshua Leonard (Addgene plasmid # 138844 ; http://n2t.net/addgene:138844 ; RRID:Addgene_138844)
  • For your References section:

    The COMET toolkit for composing customizable genetic programs in mammalian cells. Donahue PS, Draut JW, Muldoon JJ, Edelstein HI, Bagheri N, Leonard JN. Nat Commun. 2020 Feb 7;11(1):779. doi: 10.1038/s41467-019-14147-5. 10.1038/s41467-019-14147-5 PubMed 32034124