Skip to main content
Addgene

pHIE049 ZF43x12-S mKate2 (TUPV1)
(Plasmid #138729)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138729 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD561 TUPV1 CAG
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZF43x12-Spaced
  • Species
    Synthetic
  • Promoter ZF43x12-Spaced

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGACACGGAAATGTTGAATAC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Leonard lab plasmid reference number: L1531

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHIE049 ZF43x12-S mKate2 (TUPV1) was a gift from Joshua Leonard (Addgene plasmid # 138729 ; http://n2t.net/addgene:138729 ; RRID:Addgene_138729)
  • For your References section:

    The COMET toolkit for composing customizable genetic programs in mammalian cells. Donahue PS, Draut JW, Muldoon JJ, Edelstein HI, Bagheri N, Leonard JN. Nat Commun. 2020 Feb 7;11(1):779. doi: 10.1038/s41467-019-14147-5. 10.1038/s41467-019-14147-5 PubMed 32034124