pACDura3
(Plasmid #138711)

• Purpose: Expresses group II intron Ll.LtrB and IEP (LtrA) from Lactoccus lactis under control of T7 promoter. Ll.LtrB is retargeted to insert into 635s locus of LacZ gene and ura3 gene is cloned inside.
• Depositing Lab: Víctor de Lorenzo
• Publication: Velazquez et al ACS Synth Biol. 2019 Sep 20;8(9):2186-2193. doi: 10.1021/acssynbio.9b00293. Epub 2019 Sep 3.

Backbone

• Vector backbone: pACD4K-C
• Backbone manufacturer: Sigma-Aldrich
• Backbone size w/o insert (bp): 7675
• Total vector size (bp): 7264
• Modifications to backbone: First, retro-transposition-activated selectable marker (RAM) in pACD4K-C was excised by digestion with mluI enzyme. Then, optimized ura3 gene was amplified by PCR, digested with mluI and ligated with mluI-digested pACD4K-C vector.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ura3 gene
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 963
• Mutation: optimized ura3 gene for expression in Escherichia coli
• Entrez Gene: URA3 (a.k.a. YEL021W)
• Promoter: pEM7 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: mluI (not destroyed)
• 3′ cloning site: mluI (not destroyed)
• 5′ sequencing primer: ATGTCCAAGGCTACTTACAAGG
• 3′ sequencing primer: ATGATAATATCAGAGCCGGTAG

Resource Information

• Supplemental Documents:
  • pACDura3.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry