pSECC-sgSIK2-B
(Plasmid
#138671)
-
PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSECC
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgSIK2 mouse
-
gRNA/shRNA sequenceGGTGGGGTTCTACGACATCG
-
SpeciesM. musculus (mouse)
-
Entrez GeneSik2 (a.k.a. G630080D20Rik, Snf1lk2)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSECC-sgSIK2-B was a gift from Reuben Shaw (Addgene plasmid # 138671 ; http://n2t.net/addgene:138671 ; RRID:Addgene_138671) -
For your References section:
The AMPK-Related Kinases SIK1 and SIK3 Mediate Key Tumor-Suppressive Effects of LKB1 in NSCLC. Hollstein PE, Eichner LJ, Brun SN, Kamireddy A, Svensson RU, Vera LI, Ross DS, Rymoff TJ, Hutchins A, Galvez HM, Williams AE, Shokhirev MN, Screaton RA, Berdeaux R, Shaw RJ. Cancer Discov. 2019 Nov;9(11):1606-1627. doi: 10.1158/2159-8290.CD-18-1261. Epub 2019 Jul 26. 10.1158/2159-8290.CD-18-1261 PubMed 31350328