Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAMS366-4xCDRE-GFP
(Plasmid #138657)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138657 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAMS366
  • Total vector size (bp) 8962
  • Vector type
    yeast reporter plasmid
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    4xCDRE-CYC1(PM)-yeGFP
  • Species
    S. cerevisiae (budding yeast); A. victoria
  • Promoter CYC1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GTG GGT TTA GAT GAC AAG GGA GAC G
  • 3′ sequencing primer CGT ACT GTG AGC CAG AGT TG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    1. Stathopoulos AM, and Cyert MS (1997). Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 11(24): 3432–3444. 9407035. and 2. Janke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, and Knop M (2004). A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast. 21(11): 947–962. doi: 10.1002/yea.1142.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg

For construction of pAMS366-4xCDRE-GFP, we used yeGFP from pYM25 (Janke
et al. 2004, sequence available from euroscarf), sequencing showed a
644C>G (Thr>Arg) mutation."

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAMS366-4xCDRE-GFP was a gift from Sabrina Büttner (Addgene plasmid # 138657 ; http://n2t.net/addgene:138657 ; RRID:Addgene_138657)
  • For your References section:

    Stable and destabilized GFP reporters to monitor calcineurin activity in Saccharomyces cerevisiae. Diessl , J., Nandy, A., Schug, C., Habernig, L., and Büttner, S.. Microbial Cell, 2020: in press