Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET30b_OmpAT7Sav
(Plasmid #138589)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138589 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET30b
  • Backbone manufacturer
    Novagen
  • Total vector size (bp) 5821
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Glucose can be added to growth media to suppress leaky expression
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    T7-tagged streptavidin variant with native C-terminus and OmpA signal peptide for periplasmic export
  • Alt name
    OmpAT7SAV
  • Species
    Synthetic
  • Insert Size (bp)
    537
  • Promoter PT7
  • Tags / Fusion Proteins
    • OmpA export signal (N terminal on insert)
    • T7 tag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET30b_OmpAT7Sav was a gift from Markus Jeschek (Addgene plasmid # 138589 ; http://n2t.net/addgene:138589 ; RRID:Addgene_138589)
  • For your References section:

    Directed evolution of artificial metalloenzymes for in vivo metathesis. Jeschek M, Reuter R, Heinisch T, Trindler C, Klehr J, Panke S, Ward TR. Nature. 2016 Sep 29;537(7622):661-665. doi: 10.1038/nature19114. Epub 2016 Aug 29. 10.1038/nature19114 PubMed 27571282