pET30b_OmpAT7Sav
(Plasmid
#138589)
-
PurposeT7-tagged streptavidin with native C-terminus and periplasmic export signal OmpA; controlled by PT7 promoter; KanR, pBR322 ori
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET30b
-
Backbone manufacturerNovagen
- Total vector size (bp) 5821
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGlucose can be added to growth media to suppress leaky expression
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7-tagged streptavidin variant with native C-terminus and OmpA signal peptide for periplasmic export
-
Alt nameOmpAT7SAV
-
SpeciesSynthetic
-
Insert Size (bp)537
- Promoter PT7
-
Tags
/ Fusion Proteins
- OmpA export signal (N terminal on insert)
- T7 tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30b_OmpAT7Sav was a gift from Markus Jeschek (Addgene plasmid # 138589 ; http://n2t.net/addgene:138589 ; RRID:Addgene_138589) -
For your References section:
Directed evolution of artificial metalloenzymes for in vivo metathesis. Jeschek M, Reuter R, Heinisch T, Trindler C, Klehr J, Panke S, Ward TR. Nature. 2016 Sep 29;537(7622):661-665. doi: 10.1038/nature19114. Epub 2016 Aug 29. 10.1038/nature19114 PubMed 27571282