pET30b_T7Sav
(Plasmid
#138588)
-
PurposeT7-tagged streptavidin with native C-terminus controlled by PT7 promoter; KanR, pBR322 ori
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET30b
-
Backbone manufacturerNovagen
- Total vector size (bp) 5761
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGlucose can be added to growth medium to reduce leaky expression
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7-tagged streptavidin variant with native C-terminus
-
Alt nameT7SAV
-
SpeciesSynthetic
-
Insert Size (bp)483
- Promoter PT7
-
Tag
/ Fusion Protein
- T7-tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30b_T7Sav was a gift from Markus Jeschek (Addgene plasmid # 138588 ; http://n2t.net/addgene:138588 ; RRID:Addgene_138588) -
For your References section:
Biotin-independent strains of Escherichia coli for enhanced streptavidin production. Jeschek M, Bahls MO, Schneider V, Marliere P, Ward TR, Panke S. Metab Eng. 2017 Mar;40:33-40. doi: 10.1016/j.ymben.2016.12.013. Epub 2017 Jan 3. 10.1016/j.ymben.2016.12.013 PubMed 28062280