pLVX ALIX-GFP S718/721/E
(Plasmid
#138584)
-
PurposeExpresses fluorescent ALIX S718/721E in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX
- Backbone size w/o insert (bp) 7769
- Total vector size (bp) 11183
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameALIX
-
Alt namePDCD6IP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3414
-
Mutationchanged serines 718 and 721 to glutamic acids
-
GenBank IDHGNC:8766 OMIM: 608074
-
Entrez GenePDCD6IP (a.k.a. AIP1, ALIX, DRIP4, HP95, MCPH29)
- Promoter TREtight
-
Tags
/ Fusion Proteins
- h30 (C terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtcgaggtaggcgtgtacgg
- 3′ sequencing primer gaggccagaggccacttgtgtag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX ALIX-GFP S718/721/E was a gift from Wesley Sundquist (Addgene plasmid # 138584 ; http://n2t.net/addgene:138584 ; RRID:Addgene_138584)