pCDH-MSCV-4xS1m-GFP-T2A-PU
(Plasmid
#138581)
-
Purpose(Empty Backbone) For in vivo tagging
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCDH-MSCV-GFP-T2A-PU
-
Backbone manufacturerSystem Biosciences
-
Vector typeLentiviral
- Promoter MSCV
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- S1m tag (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acaaaaattcaaaattttatcga
- 3′ sequencing primer ctacacgcgagacgggtgactg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please Note: Plasmid contains a 75 basepair deletion of a repeat sequence in the backbone upstream of the EF-1a core promoter. It is not known how this deletion affects plasmid function.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-MSCV-4xS1m-GFP-T2A-PU was a gift from Yin-Yuan Mo (Addgene plasmid # 138581 ; http://n2t.net/addgene:138581 ; RRID:Addgene_138581) -
For your References section:
IGF2BP2 regulates DANCR by serving as an N6-methyladenosine reader. Hu X, Peng WX, Zhou H, Jiang J, Zhou X, Huang D, Mo YY, Yang L. Cell Death Differ. 2019 Dec 5. pii: 10.1038/s41418-019-0461-z. doi: 10.1038/s41418-019-0461-z. 10.1038/s41418-019-0461-z PubMed 31804607
