pGL4.11-Cd36-promoter
(Plasmid #138572)

• Purpose: Firefly luciferase reporter fused with a 1296 bp fragment of mouse Cd36 promoter
• Depositing Lab: Lora Hooper
• Publication: Kuang et al Science. 2019 Sep 27;365(6460):1428-1434. doi: 10.1126/science.aaw3134.

Backbone

• Vector backbone: pGL4.11
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6114
• Modifications to backbone: Digest with KpnI and XhoI and ligate with insert
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cd36 Promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 1296
• GenBank ID: NC_000071.6
• Entrez Gene: Cd36 (a.k.a. FAT, GPIV, Scarb3)
• Promoter: SV40

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: RVprimer3
• 3′ sequencing primer: TGGCTTTACCAACAGTACCGGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry