Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL4.11-Cd36-promoter
(Plasmid #138572)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138572 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL4.11
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6114
  • Modifications to backbone
    Digest with KpnI and XhoI and ligate with insert
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cd36 Promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1296
  • GenBank ID
    NC_000071.6
  • Entrez Gene
    Cd36 (a.k.a. FAT, GPIV, Scarb3)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer TGGCTTTACCAACAGTACCGGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.11-Cd36-promoter was a gift from Lora Hooper (Addgene plasmid # 138572 ; http://n2t.net/addgene:138572 ; RRID:Addgene_138572)
  • For your References section:

    The intestinal microbiota programs diurnal rhythms in host metabolism through histone deacetylase 3. Kuang Z, Wang Y, Li Y, Ye C, Ruhn KA, Behrendt CL, Olson EN, Hooper LV. Science. 2019 Sep 27;365(6460):1428-1434. doi: 10.1126/science.aaw3134. 10.1126/science.aaw3134 PubMed 31604271