Skip to main content
Addgene

pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract
(Plasmid #138525)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138525 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1-puro U6 sgRNA BfuA1 stuffer
  • Backbone size w/o insert (bp) 7145
  • Total vector size (bp) 7424
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Control non-PRC2 binding A-tract repeat RNA
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract was a gift from Richard Jenner (Addgene plasmid # 138525 ; http://n2t.net/addgene:138525 ; RRID:Addgene_138525)
  • For your References section:

    G-tract RNA removes Polycomb repressive complex 2 from genes. Beltran M, Tavares M, Justin N, Khandelwal G, Ambrose J, Foster BM, Worlock KB, Tvardovskiy A, Kunzelmann S, Herrero J, Bartke T, Gamblin SJ, Wilson JR, Jenner RG. Nat Struct Mol Biol. 2019 Oct;26(10):899-909. doi: 10.1038/s41594-019-0293-z. Epub 2019 Sep 23. 10.1038/s41594-019-0293-z PubMed 31548724