Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract
(Plasmid #138524)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138524 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1-puro U6 sgRNA BfuA1 stuffer
  • Backbone size w/o insert (bp) 7145
  • Total vector size (bp) 7423
  • Modifications to backbone
    Insertion of a spacer and G-tract repeat RNA sequence
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PRC2-binding G-tract repeat RNA
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract was a gift from Richard Jenner (Addgene plasmid # 138524 ; http://n2t.net/addgene:138524 ; RRID:Addgene_138524)
  • For your References section:

    G-tract RNA removes Polycomb repressive complex 2 from genes. Beltran M, Tavares M, Justin N, Khandelwal G, Ambrose J, Foster BM, Worlock KB, Tvardovskiy A, Kunzelmann S, Herrero J, Bartke T, Gamblin SJ, Wilson JR, Jenner RG. Nat Struct Mol Biol. 2019 Oct;26(10):899-909. doi: 10.1038/s41594-019-0293-z. Epub 2019 Sep 23. 10.1038/s41594-019-0293-z PubMed 31548724