Skip to main content
Addgene

pMAL-c2X-ORF24-NTD
(Plasmid #138465)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138465 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMAL-c2X
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6588
  • Total vector size (bp) 7191
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ORF24
  • Species
    KSHV (HHV-8)
  • Insert Size (bp)
    603
  • Mutation
    Amino acids 1-201
  • Entrez Gene
    ORF24 (a.k.a. HHV8GK18_gp27)
  • Promoter tac
  • Tag / Fusion Protein
    • MBP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-c2X-ORF24-NTD was a gift from Britt Glaunsinger (Addgene plasmid # 138465 ; http://n2t.net/addgene:138465 ; RRID:Addgene_138465)
  • For your References section:

    The gammaherpesviral TATA-box-binding protein directly interacts with the CTD of host RNA Pol II to direct late gene transcription. Castaneda AF, Didychuk AL, Louder RK, McCollum CO, Davis ZH, Nogales E, Glaunsinger BA. PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep. 10.1371/journal.ppat.1008843 PubMed 32886723