Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA4/TO-mu24 1-216-2xStrep
(Plasmid #138446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138446 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5118
  • Total vector size (bp) 5758
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mu24
  • Species
    MHV68
  • Insert Size (bp)
    648
  • Mutation
    Amino acids 1-216
  • Promoter CMV
  • Tag / Fusion Protein
    • Strep (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4/TO-mu24 1-216-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 138446 ; http://n2t.net/addgene:138446 ; RRID:Addgene_138446)
  • For your References section:

    The gammaherpesviral TATA-box-binding protein directly interacts with the CTD of host RNA Pol II to direct late gene transcription. Castaneda AF, Didychuk AL, Louder RK, McCollum CO, Davis ZH, Nogales E, Glaunsinger BA. PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep. 10.1371/journal.ppat.1008843 PubMed 32886723