pCMV-HA_N-mouse Bcl6
(Plasmid
#138410)
-
PurposeExpress mouse Bcl6 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-HA-N
- Backbone size w/o insert (bp) 3782
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB cell lymphoma 6
-
Alt nameBcl6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2124
-
GenBank ID12053
-
Entrez GeneBcl6 (a.k.a. Bcl5)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer ACCGAGATCTCTCGAATGGCCTCCCCGGCTGAC
- 3′ sequencing primer TGGATCCCCGCGGCCTCAGCAGGCTTTGGGGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA_N-mouse Bcl6 was a gift from Bruce Beutler (Addgene plasmid # 138410 ; http://n2t.net/addgene:138410 ; RRID:Addgene_138410) -
For your References section:
Mutual inhibition between Prkd2 and Bcl6 controls T follicular helper cell differentiation. Misawa T, SoRelle JA, Choi JH, Yue T, Wang KW, McAlpine W, Wang J, Liu A, Tabeta K, Turer EE, Evers B, Nair-Gill E, Poddar S, Su L, Ou F, Yu L, Russell J, Ludwig S, Zhan X, Hildebrand S, Li X, Tang M, Murray AR, Moresco EMY, Beutler B. Sci Immunol. 2020 Jan 24;5(43):eaaz0085. doi: 10.1126/sciimmunol.aaz0085. 10.1126/sciimmunol.aaz0085 PubMed 31980486