Addgene: pAJ1 Skip to main content
Addgene

pAJ1
(Plasmid #138379)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138379 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET21a
  • Backbone size w/o insert (bp) 15815
  • Total vector size (bp) 5000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    RpoA
  • Species
    E. coli
  • Insert Size (bp)
    990
  • GenBank ID
    947794
  • Entrez Gene
    rpoA (a.k.a. b3295, ECK3282, pez, phs, sez)
  • Promoter T7

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    RpoB
  • Species
    E. coli
  • Insert Size (bp)
    4029
  • GenBank ID
    948488
  • Entrez Gene
    rpoB (a.k.a. b3987, ECK3978, ftsR, groN, nitB, rif, ron, sdgB, stl, stv, tabD)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ccgtcgacttgtcagcgagctgaggaaccc
  • 3′ sequencing primer ggttttaacccgacagcagtgacctgtttgagcg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    RpoC
  • Alt name
    RpoC dCT
  • Species
    E. coli
  • Insert Size (bp)
    4185
  • Mutation
    Clamp toe deletion: Δ(Tyr144-Lys179) ::(G144-S145). PreScission protease site (GE Healthcare; LEVLFQGP) is inserted between the C-terminus of RpoC and the (His)10-tag
  • GenBank ID
    948487
  • Entrez Gene
    rpoC (a.k.a. b3988, ECK3979, tabB)
  • Tag / Fusion Protein
    • His10 (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer gcggattgtgctaactccgacgggagcaaatcc
  • 3′ sequencing primer gcttattttgagtggactattgaggccagag
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    rpoZ
  • Species
    E. coli
  • Insert Size (bp)
    276
  • GenBank ID
    948160
  • Entrez Gene
    rpoZ (a.k.a. b3649, ECK3639, spoS)

Cloning Information for Gene/Insert 4

  • Cloning method Unknown
  • 5′ sequencing primer gcttcaatgactgcagacttaagaaggagattaatg
  • 3′ sequencing primer ccccgaaaagtgccacctgacgtagttatccg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pEcRNAP6, Twist KA, Husnain SI, Franke JD, Jain D, Campbell EA, Nickels BE, Thomas MS, Darst SA, Westblade LF

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A novel method for the production of in vivo-assembled, recombinant Escherichia coli RNA polymerase lacking the alpha C-terminal domain.2
Twist KA, Husnain SI, Franke JD, Jain D, Campbell EA, Nickels BE, Thomas MS, Darst SA, Westblade LF
Protein Sci. 2011 Jun;20(6):986-95. doi: 10.1002/pro.622. Epub 2011 Apr 26.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAJ1 was a gift from Seth Darst (Addgene plasmid # 138379 ; http://n2t.net/addgene:138379 ; RRID:Addgene_138379)
  • For your References section:

    Structural basis for transcription activation by Crl through tethering of sigma(S) and RNA polymerase. Cartagena AJ, Banta AB, Sathyan N, Ross W, Gourse RL, Campbell EA, Darst SA. Proc Natl Acad Sci U S A. 2019 Sep 17;116(38):18923-18927. doi: 10.1073/pnas.1910827116. Epub 2019 Sep 4. 10.1073/pnas.1910827116 PubMed 31484766