Skip to main content
Addgene

lentiCRISPR v2-sgMyc_2
(Plasmid #138346)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138346 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Zhang lab
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cMyc sgRNA
  • Alt name
    sgRNA targeting mouse Myc
  • gRNA/shRNA sequence
    AGAGGCAAACCCCTGCCAAG
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgMyc_2 was a gift from Yi Zhang (Addgene plasmid # 138346 ; http://n2t.net/addgene:138346 ; RRID:Addgene_138346)

  • For your References section:

    Myc and Dnmt1 impede the pluripotent to totipotent state transition in embryonic stem cells. Fu X, Wu X, Djekidel MN, Zhang Y. Nat Cell Biol. 2019 Jul;21(7):835-844. doi: 10.1038/s41556-019-0343-0. Epub 2019 Jun 17. 10.1038/s41556-019-0343-0 PubMed 31209294
Related items:
Commonly requested with: