-
PurposeDox-inducible codon-optimized mouse Dux
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57-MCS1-P2A-MCS2 (Neo)
-
Backbone manufacturerBroad Insitute
- Backbone size w/o insert (bp) 7943
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDux
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2088
-
Entrez GeneDux (a.k.a. AW822073, Dux4, Duxbl, EG664783)
- Promoter TRE
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer agctcgtttagtgaaccgtcagat (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-MCS1-P2A-MCS2-mDux was a gift from Yi Zhang (Addgene plasmid # 138320 ; http://n2t.net/addgene:138320 ; RRID:Addgene_138320) -
For your References section:
Myc and Dnmt1 impede the pluripotent to totipotent state transition in embryonic stem cells. Fu X, Wu X, Djekidel MN, Zhang Y. Nat Cell Biol. 2019 Jul;21(7):835-844. doi: 10.1038/s41556-019-0343-0. Epub 2019 Jun 17. 10.1038/s41556-019-0343-0 PubMed 31209294