Skip to main content
Addgene

pMtb CblA
(Plasmid #138298)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138298 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pet28b
  • Backbone manufacturer
    EMD millipore
  • Backbone size w/o insert (bp) 5368
  • Total vector size (bp) 6370
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mtb CblA
  • Alt name
    Rv1496
  • Alt name
    Probably GTPase Rv1496
  • Species
    M. tuberculosis
  • Insert Size (bp)
    1005
  • GenBank ID
    NP_216012.1 NP_216012.1
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMtb CblA was a gift from Ruma Banerjee (Addgene plasmid # 138298 ; http://n2t.net/addgene:138298 ; RRID:Addgene_138298)

  • For your References section:

    Itaconyl-CoA forms a stable biradical in methylmalonyl-CoA mutase and derails its activity and repair. Ruetz M, Campanello GC, Purchal M, Shen H, McDevitt L, Gouda H, Wakabayashi S, Zhu J, Rubin EJ, Warncke K, Mootha VK, Koutmos M, Banerjee R. Science. 2019 Nov 1;366(6465):589-593. doi: 10.1126/science.aay0934. 10.1126/science.aay0934 PubMed 31672889
Related items:
Commonly requested with: