Skip to main content
Addgene

pMtb MCM
(Plasmid #138296)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138296 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETduet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 9520
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mutA
  • Alt name
    Rv1492
  • Species
    M. tuberculosis
  • Insert Size (bp)
    1893
  • Mutation
    inserted TEV cleavage site between His-tag and mutA
  • GenBank ID
    NP_216008.1 NP_216008.1
  • Promoter T7
  • Tags / Fusion Proteins
    • His tag (N terminal on backbone)
    • TEV cleavage site

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ttgtacacggccgcataatc
  • 3′ sequencing primer gattatgcggccgtgtacaa
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mutB
  • Alt name
    Rv1493
  • Species
    M. tuberculosis
  • Insert Size (bp)
    2253
  • GenBank ID
    NP_216009.1 NP_216009.1
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer ttgtacacggccgcataatc
  • 3′ sequencing primer T7 terminal
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMtb MCM was a gift from Ruma Banerjee (Addgene plasmid # 138296 ; http://n2t.net/addgene:138296 ; RRID:Addgene_138296)
  • For your References section:

    Itaconyl-CoA forms a stable biradical in methylmalonyl-CoA mutase and derails its activity and repair. Ruetz M, Campanello GC, Purchal M, Shen H, McDevitt L, Gouda H, Wakabayashi S, Zhu J, Rubin EJ, Warncke K, Mootha VK, Koutmos M, Banerjee R. Science. 2019 Nov 1;366(6465):589-593. doi: 10.1126/science.aay0934. 10.1126/science.aay0934 PubMed 31672889