Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
(Plasmid #138295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138295 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9 wt (pSpCAS9(BB)-2A-GFP)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Backbone size w/o insert (bp) 9300
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA TRIM21
  • Alt name
    E3 ubiquitin-protein ligase TRIM21
  • gRNA/shRNA sequence
    GAAACACCGTGACCACGCCA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    TRIM21 (a.k.a. RNF81, RO52, Ro/SSA, SSA, SSA1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer U6 promoter forward: GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21 was a gift from Gaudenz Danuser (Addgene plasmid # 138295 ; http://n2t.net/addgene:138295 ; RRID:Addgene_138295)
  • For your References section:

    Mechanical regulation of glycolysis via cytoskeleton architecture. Park JS, Burckhardt CJ, Lazcano R, Solis LM, Isogai T, Li L, Chen CS, Gao B, Minna JD, Bachoo R, DeBerardinis RJ, Danuser G. Nature. 2020 Feb 12. pii: 10.1038/s41586-020-1998-1. doi: 10.1038/s41586-020-1998-1. 10.1038/s41586-020-1998-1 PubMed 32051585