pLVX neo PFKP-GFP K281R
(Plasmid #138288)

• Purpose: Mammalian Expression, Lentiviral. Expression of human phosphofructokinase platelet isoform PFKP-GFP fusion protein with K281R mutation
• Depositing Lab: Gaudenz Danuser
• Publication: Park et al Nature. 2020 Feb 12. pii: 10.1038/s41586-020-1998-1. doi: 10.1038/s41586-020-1998-1.

Backbone

• Vector backbone: pLVX neo
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8140
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PFKP
• Alt name: ATP-dependent 6-phosphofructokinase, platelet type
• Species: H. sapiens (human)
• Insert Size (bp): 2355
• Mutation: K281R
• Entrez Gene: PFKP (a.k.a. ATP-PFK, PFK-C, PFK-P, PFKF)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: CMV forward: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: IRES-R: CCTCACATTGCCAAAAGACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Thermo Ultimate lite Orfeome library: IOH4086; pENTR(tm)221

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry