pFP.E227
(Plasmid
#138249)
-
PurposeReporter plasmid - Expresses three fluorescent reporters from three different ECF promoters
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB4A3
-
Backbone manufacturerBioBrick vector, IGEM registry
- Backbone size w/o insert (bp) 3340
- Total vector size (bp) 6206
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)729
- Promoter iP16_3622
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTerminator
-
Alt nameB0015
-
SpeciesSynthetic
-
Insert Size (bp)129
Gene/Insert 3
-
Gene/Insert namemTagBFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter P17_up1691
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameTerminator
-
Alt nameB0015
-
Insert Size (bp)129
Gene/Insert 5
-
Gene/Insert namegfp
-
Alt namegfpmut3b
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter P20_992
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameTerminator
-
Alt nameB0015
-
Insert Size (bp)129
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFP.E227 was a gift from Baojun Wang (Addgene plasmid # 138249 ; http://n2t.net/addgene:138249 ; RRID:Addgene_138249) -
For your References section:
An expanded library of orthogonal split inteins enables modular multi-peptide assemblies. Pinto F, Thornton EL, Wang B. Nat Commun. 2020 Mar 23;11(1):1529. doi: 10.1038/s41467-020-15272-2. 10.1038/s41467-020-15272-2 PubMed 32251274