pFP.E222
(Plasmid #138248)

• Purpose: Three input / three output logic circuit plasmid - Expresses different intein split ECFs from different inducible promoters
• Depositing Lab: Baojun Wang
• Publication: Pinto et al Nat Commun. 2020 Mar 23;11(1):1529. doi: 10.1038/s41467-020-15272-2.

Backbone

• Vector backbone: pSB3K3
• Backbone manufacturer: BioBrick vector, IGEM registry
• Backbone size w/o insert (bp): 3252
• Total vector size (bp): 5755
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: araC
• Insert Size (bp): 930
• Entrez Gene: araC (a.k.a. b0064, ECK0065)
• Promoter: iPC

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: VF2 - TGCCACCTGACGTCTAAGAA

Gene/Insert 2

• Gene/Insert name: ECF20.N.(VDA).M86.N2
• Species: Synthetic
• Insert Size (bp): 624
• Promoter: P(araBAD)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: araC_F2 - AACCCACTGGTGATACCATTCG

Gene/Insert 3

• Gene/Insert name: Terminator
• Alt name: L3S2P21
• Species: Synthetic
• Insert Size (bp): 61

Gene/Insert 4

• Gene/Insert name: SspGyrB.C2.(SAK).ECF16.C
• Species: Synthetic
• Insert Size (bp): 378
• Promoter: P(araBAD)

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: (P484)_E20N.M86.F - AGCGAACATGCCTGTGAAGTGGATGCTTGCATCTCGGGAGATAGTTTGATCAGC

Gene/Insert 5

• Gene/Insert name: Terminator
• Alt name: B0015
• Species: Synthetic
• Insert Size (bp): 129

Gene/Insert 6

• Gene/Insert name: rhaS
• Alt name: b3905
• Alt name: ECK3898
• Alt name: rhaC2
• Species: Escherichia coli str. K-12 substr. MG1655
• Insert Size (bp): 837
• GenBank ID: NP_418341.1
• Promoter: iJ23101

Cloning Information for Gene/Insert 6

• Cloning method: Gibson Cloning
• 5′ sequencing primer: (P768)_SspGyrB.ECF16.F - TTTGTCCATAACAGTGCAAAATTTGCAGCAAGTGATGAACAGC

Gene/Insert 7

• Gene/Insert name: ECF17.N.(NPC).NrdJ-1.N2
• Species: Synthetic
• Insert Size (bp): 609
• Promoter: P(rhaBAD)

Cloning Information for Gene/Insert 7

• Cloning method: Gibson Cloning
• 5′ sequencing primer: rhaS_F - GGATACTGCCCATCCAGCTC

Gene/Insert 8

• Gene/Insert name: Terminator
• Alt name: ECK120033737
• Species: Synthetic
• Insert Size (bp): 57

Gene/Insert 9

• Gene/Insert name: M86.C2.(SDL).ECF20.C
• Species: Synthetic
• Insert Size (bp): 435
• Promoter: P(rhaBAD)

Cloning Information for Gene/Insert 9

• Cloning method: Gibson Cloning
• 5′ sequencing primer: (P769)_NrdJ-1.N.FII - AATCCGTGTTGTCTGGTTGGTAGCAGC

Gene/Insert 10

• Gene/Insert name: Terminator
• Alt name: B0015
• Insert Size (bp): 129

Gene/Insert 11

• Gene/Insert name: luxR
• Alt name: VFA0925
• Species: Vibrio fischeri ES114
• Insert Size (bp): 753
• GenBank ID: YP_206883.1
• Promoter: J23115

Cloning Information for Gene/Insert 11

• Cloning method: Gibson Cloning
• 5′ sequencing primer: (P493)_E20C.F - ACCCGTCCGGCACCGGATGAACAGCTGGAAGC

Gene/Insert 12

• Gene/Insert name: Terminator
• Alt name: B0015
• Species: Synthetic
• Insert Size (bp): 129

Gene/Insert 13

• Gene/Insert name: ECF16.N.(AGG).SspGyrB.N2
• Species: Synthetic
• Insert Size (bp): 684
• Promoter: P(lux2)

Cloning Information for Gene/Insert 13

• Cloning method: Gibson Cloning
• 5′ sequencing primer: LuxR_seq.F - CAGTGAGCGTACTGTCACTTTCC

Gene/Insert 14

• Gene/Insert name: Terminator
• Alt name: L3S2P21
• Species: Synthetic
• Insert Size (bp): 61

Gene/Insert 15

• Gene/Insert name: NrdJ-1.C2.(SEI).ECF17.C
• Species: Synthetic
• Insert Size (bp): 363
• Promoter: P(lux2)

Cloning Information for Gene/Insert 15

• Cloning method: Gibson Cloning
• 5′ sequencing primer: LuxR_seq.F - CAGTGAGCGTACTGTCACTTTCC
• 3′ sequencing primer: VR - ATTACCGCCTTTGAGTGAGC

Resource Information

• Supplemental Documents:
  • pFP-E222.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry