CDKN1A sgRNA
(Plasmid
#138189)
-
Purpose3rd generation lentiviral gRNA plasmid targeting human CDKN1A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiCRISPRv2 hygro
-
Backbone manufacturerBrett Stringer (Addgene plasmid #98291)
- Total vector size (bp) 15261
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDKN1A
-
Alt namep21
-
gRNA/shRNA sequenceCACCGTCACCGAGACACCACTGGA
-
SpeciesH. sapiens (human)
-
GenBank IDNG_009364.1 NM_000389.5
-
Entrez GeneCDKN1A (a.k.a. CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3') (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CDKN1A sgRNA was a gift from Wen Xue (Addgene plasmid # 138189 ; http://n2t.net/addgene:138189 ; RRID:Addgene_138189) -
For your References section:
Depletion of TRRAP induces p53-independent senescence in liver cancer by downregulating mitotic genes. Kwan SY, Sheel A, Song CQ, Zhang XO, Jiang T, Dang H, Cao Y, Ozata DM, Mou H, Yin H, Weng Z, Wang XW, Xue W. Hepatology. 2019 Jun 12. doi: 10.1002/hep.30807. 10.1002/hep.30807 PubMed 31188495