Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

KAT2A sgRNA1
(Plasmid #138185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 52961)
  • Total vector size (bp) 14873
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KAT2A
  • Alt name
    GCN5
  • Alt name
    GCN5L2
  • gRNA/shRNA sequence
    CACCGCTGCTGGAAAAGTTCCGAG
  • Species
    H. sapiens (human)
  • GenBank ID
    NC_000017.11 NM_021078.3
  • Entrez Gene
    KAT2A (a.k.a. GCN5, GCN5L2, PCAF-b, hGCN5)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KAT2A sgRNA1 was a gift from Wen Xue (Addgene plasmid # 138185 ; http://n2t.net/addgene:138185 ; RRID:Addgene_138185)
  • For your References section:

    Depletion of TRRAP induces p53-independent senescence in liver cancer by downregulating mitotic genes. Kwan SY, Sheel A, Song CQ, Zhang XO, Jiang T, Dang H, Cao Y, Ozata DM, Mou H, Yin H, Weng Z, Wang XW, Xue W. Hepatology. 2019 Jun 12. doi: 10.1002/hep.30807. 10.1002/hep.30807 PubMed 31188495