H513 px330.sgActin.UTR.2
(Plasmid
#138176)
-
PurposeCRISPR SONIC: Encodes codon-optimized SpCas9 and gRNA for targeting 3' UTR of β-actin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgActin
-
gRNA/shRNA sequenceCCACCCCCACTCCTAAGAGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneActb (a.k.a. Actx, E430023M04Rik, beta-actin)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H513 px330.sgActin.UTR.2 was a gift from Wen Xue (Addgene plasmid # 138176 ; http://n2t.net/addgene:138176 ; RRID:Addgene_138176) -
For your References section:
CRISPR-SONIC: targeted somatic oncogene knock-in enables rapid in vivo cancer modeling. Mou H, Ozata DM, Smith JL, Sheel A, Kwan SY, Hough S, Kucukural A, Kennedy Z, Cao Y, Xue W. Genome Med. 2019 Apr 16;11(1):21. doi: 10.1186/s13073-019-0627-9. 10.1186/s13073-019-0627-9 PubMed 30987660