pFP.R265
(Plasmid #138167)

• Purpose: Expresses the split mCherry reporter interrupted by the SspDnaB M86 artificially mini-intein (in cis)
• Depositing Lab: Baojun Wang
• Publication: Pinto et al Nat Commun. 2020 Mar 23;11(1):1529. doi: 10.1038/s41467-020-15272-2.

Backbone

• Vector backbone: pSB3T5
• Backbone manufacturer: BioBrick vector, IGEM registry
• Backbone size w/o insert (bp): 3252
• Total vector size (bp): 5683
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: araC
• Insert Size (bp): 930
• Entrez Gene: araC (a.k.a. b0064, ECK0065)
• Promoter: iPC

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: VF2 - TGCCACCTGACGTCTAAGAA

Gene/Insert 2

• Gene/Insert name: mCherryN(VDA).M86.(SDL)mCherryC.H6
• Species: Synthetic
• Insert Size (bp): 1209
• Promoter: P(araBAD)
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: araC_F2 - AACCCACTGGTGATACCATTCG
• 3′ sequencing primer: VR - ATTACCGCCTTTGAGTGAGC

Resource Information

• Supplemental Documents:
  • pFP.R265.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry