pTJK422
(Plasmid
#138002)
-
PurposeSIX2 expression. Vector also expresses GFP under control of hUBC promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWCC43
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable ; Stellar Cells
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSIX2
-
SpeciesH. sapiens (human)
-
MutationNone
-
Entrez GeneSIX2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site Sal1 (unknown if destroyed)
- 5′ sequencing primer TTCATTCTCAAGCCTCAGAC
- 3′ sequencing primer GGACGCTCGCTGCGCCCTTCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTJK422 was a gift from Tami Kingsbury (Addgene plasmid # 138002 ; http://n2t.net/addgene:138002 ; RRID:Addgene_138002)