Recall-miniCMV-sfGFP
(Plasmid
#137995)
-
Purpose(Empty Backbone) Backbone for generation of ClonMapper Recall Plasmid
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBR322
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CTAGAAGGCACAGTCGAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://docs.brocklab.com/clonmapper for an updated protocol.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Recall-miniCMV-sfGFP was a gift from Amy Brock (Addgene plasmid # 137995 ; http://n2t.net/addgene:137995 ; RRID:Addgene_137995) -
For your References section:
Functionalized Lineage Tracing for the Study and Manipulation of Heterogeneous Cell Populations. Gardner A, Morgan D, Al'Khafaji A, Brock A. Methods Mol Biol. 2022;2394:109-131. doi: 10.1007/978-1-0716-1811-0_8. 10.1007/978-1-0716-1811-0_8 PubMed 35094325
