pGL3-NRASshort
(Plasmid
#13799)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3 promoter
-
Backbone manufacturerpromega
- Backbone size w/o insert (bp) 5010
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNRAS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1140
-
GenBank IDNM_002524
-
Entrez GeneNRAS (a.k.a. ALPS4, CMNS, KRAS, N-ras, NCMS, NRAS1, NS6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (destroyed during cloning)
- 3′ cloning site Xba1 (destroyed during cloning)
- 5′ sequencing primer AAGGGCGGAAAGATCGCCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-NRASshort was a gift from Frank Slack (Addgene plasmid # 13799 ; http://n2t.net/addgene:13799 ; RRID:Addgene_13799) -
For your References section:
RAS is regulated by the let-7 microRNA family. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. Cell. 2005 Mar 11. 120(5):635-47. 10.1016/j.cell.2005.01.014 PubMed 15766527