Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pM1s3ATScsg-Etag
(Plasmid #137946)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137946 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMUT1
  • Backbone manufacturer
    Native to E. coli Nissle
  • Backbone size w/o insert (bp) 3173
  • Modifications to backbone
    pMUT1 was modified with an insulated cassette with a selection marker
  • Vector type
    Bacterial Expression, Synthetic Biology ; For use with E. coli Nissle in the mouse gut

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Synthetic curli operon
  • Insert Size (bp)
    3285
  • Promoter pTlpA36

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cattactcgcatccattctcaggc
  • 3′ sequencing primer acctgctgcggctgcaatcccagg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Synthetic curli operon
  • Species
    Synthetic
  • Insert Size (bp)
    3285

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM1s3ATScsg-Etag was a gift from Neel Joshi (Addgene plasmid # 137946 ; http://n2t.net/addgene:137946 ; RRID:Addgene_137946)
  • For your References section:

    Plasmid Vectors for in Vivo Selection-Free Use with the Probiotic E. coli Nissle 1917. Kan A, Gelfat I, Emani S, Praveschotinunt P, Joshi NS. ACS Synth Biol. 2020 Dec 10. doi: 10.1021/acssynbio.0c00466. 10.1021/acssynbio.0c00466 PubMed 33301298