R26-H2B-mCherry HR donor vector
(Plasmid #137928)

• Purpose: R0SA26 knock-in vector with homologous recombination-based method
• Depositing Lab: Hiroshi Kiyonari
• Publication: Abe et al Cell Rep. 2020 May 19;31(7):107653. doi: 10.1016/j.celrep.2020.107653.

Backbone

• Vector backbone: pBluescriptII SK+
• Backbone size w/o insert (bp): 2929
• Total vector size (bp): 6006
• Vector type: Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SA-H2B-mCherry-bpA with homology arms
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 3077

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GTAATACGACTCACTATAGGGC
• 3′ sequencing primer: AATTAACCCTCACTAAAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The mCherry was gifted from the late Dr. Roger Y. Tsien.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry