Skip to main content
Addgene

R26-EGFP HMEJ donor vector
(Plasmid #137927)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137927 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBluescriptII SK+
  • Backbone size w/o insert (bp) 2865
  • Total vector size (bp) 5644
  • Vector type
    Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SA-EGFP-bpA with homology arms
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    2779

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer GTAATACGACTCACTATAGGGC
  • 3′ sequencing primer AATTAACCCTCACTAAAGGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    R26-EGFP HMEJ donor vector was a gift from Hiroshi Kiyonari (Addgene plasmid # 137927 ; http://n2t.net/addgene:137927 ; RRID:Addgene_137927)

  • For your References section:

    Pronuclear Microinjection during S-Phase Increases the Efficiency of CRISPR-Cas9-Assisted Knockin of Large DNA Donors in Mouse Zygotes. Abe T, Inoue KI, Furuta Y, Kiyonari H. Cell Rep. 2020 May 19;31(7):107653. doi: 10.1016/j.celrep.2020.107653. 10.1016/j.celrep.2020.107653 PubMed 32433962
Related items:
Commonly requested with: