pM2s2AsG
(Plasmid #137924)

• Purpose: E. coli Nissle pMUT2-derived plasmid with ampicillin resistance and constitutive GFP expression
• Depositing Lab: Neel Joshi
• Publication: Kan et al ACS Synth Biol. 2020 Dec 10. doi: 10.1021/acssynbio.0c00466.

Backbone

• Vector backbone: pMUT2
• Backbone manufacturer: Native to E. coli Nissle
• Backbone size w/o insert (bp): 3173
• Modifications to backbone: pMUT2 was modified with an insulated cassette with a selection marker
• Vector type: Bacterial Expression, Synthetic Biology ; For use with E. coli Nissle in the mouse gut

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Mach1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Superfolder GFP
• Alt name: sfGFP
• Species: Synthetic
• Insert Size (bp): 861
• GenBank ID: ADW83736.1
• Promoter: J23101

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTCCTTATCATCTGGCGAATCGG
• 3′ sequencing primer: GAGACGAGACGAGACAGCCTG

Resource Information

• Supplemental Documents:
  • pMUT2s2AsG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry