pM1s3AsG
(Plasmid #137921)

• Purpose: E. coli Nissle pMUT1-derived plasmid with ampicillin resistance and constitutive GFP expression
• Depositing Lab: Neel Joshi
• Publication: Kan et al ACS Synth Biol. 2020 Dec 10. doi: 10.1021/acssynbio.0c00466.

Backbone

• Vector backbone: pMUT1
• Backbone manufacturer: Native to E. coli Nissle
• Backbone size w/o insert (bp): 3173
• Modifications to backbone: pMUT1 was modified with an insulated cassette with a selection marker
• Vector type: Bacterial Expression, Synthetic Biology ; For use with E. coli Nissle in the mouse gut

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Superfolder GFP
• Alt name: sfGFP
• Species: Synthetic
• Insert Size (bp): 861
• GenBank ID: ADW83736.1
• Promoter: J23101

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTCCTTATCATCTGGCGAATCGG
• 3′ sequencing primer: GAGACGAGACGAGACAGCCTGAG

Resource Information

• Supplemental Documents:
  • pMUT1s3AsG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry