pPN440
(Plasmid
#137874)
-
PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEP163
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTCF4
-
gRNA/shRNA sequenceTCGCGCGTGGGGCGGCACTG, GGGAGCAGGCGACCATAGAG, TTATTCGTGTTGCCGCTTCT
-
SpeciesH. sapiens (human)
-
Entrez GeneTCF4 (a.k.a. CDG2T, E2-2, FCD2, FECD3, ITF-2, ITF2, PTHS, SEF-2, SEF2, SEF2-1, SEF2-1A, SEF2-1B, SEF2-1D, TCF-4, bHLHb19)
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional insert: mRFP-T2A-BlasticidinR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPN440 was a gift from Lindy Barrett (Addgene plasmid # 137874 ; http://n2t.net/addgene:137874 ; RRID:Addgene_137874) -
For your References section:
A multiplexed gRNA piggyBac transposon system facilitates efficient induction of CRISPRi and CRISPRa in human pluripotent stem cells. Hazelbaker DZ, Beccard A, Angelini G, Mazzucato P, Messana A, Lam D, Eggan K, Barrett LE. Sci Rep. 2020 Jan 20;10(1):635. doi: 10.1038/s41598-020-57500-1. 10.1038/s41598-020-57500-1 PubMed 31959800