FRB-CTEVp(WT)
(Plasmid #137832)

• Purpose: Cytosolic split-TEV protease chain with FRB Rapamycin sensing domain, C-terminal WT TEV protease
• Depositing Lab: Joshua Leonard
• Publication: Dolberg et al Nat Chem Biol. 2021 May;17(5):531-539. doi: 10.1038/s41589-020-00729-8. Epub 2021 Feb 1.

Backbone

• Vector backbone: pcDNA3.1/HygroR(+)
• Backbone size w/o insert (bp): 4321
• Total vector size (bp): 5131
• Modifications to backbone: Modified from pcDNA3.1/HygroR(+) to lack HygroR.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FRB-CTEVp(WT)
• Species: H. sapiens (human)
• Insert Size (bp): 810
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3x FLAG (N terminal on insert)
  • NES (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pTD844.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/863530v2 for bioRxiv preprint.