Skip to main content
Addgene

pPGK-T7/2-CD44s (fl)
(Plasmid #137812)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137812 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mini pBR322
  • Backbone manufacturer
    lab Guenthert
  • Backbone size w/o insert (bp) 4320
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD44s (fl)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1090
  • Mutation
    full length, I186T and I253V on CD44
  • Entrez Gene
    CD44 (a.k.a. CDW44, CSPG8, ECM-III, ECMR-III, H-CAM, HCELL, HUTCH-1, HUTCH-I, Hermes-1, IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1)
  • Promoter PGK
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer GTAATACGACTCACTATAGG
  • 3′ sequencing primer GCTCACCATGGTGGCGACCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS result found mutations I186T and I253V when compared to CD44 [XP_016874074.1]. Depositor confirmed that this does not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPGK-T7/2-CD44s (fl) was a gift from Ursula Gunthert (Addgene plasmid # 137812 ; http://n2t.net/addgene:137812 ; RRID:Addgene_137812)
  • For your References section:

    A novel antiapoptotic mechanism based on interference of Fas signaling by CD44 variant isoforms. Mielgo A, van Driel M, Bloem A, Landmann L, Gunthert U. Cell Death Differ. 2006 Mar;13(3):465-77. doi: 10.1038/sj.cdd.4401763. 10.1038/sj.cdd.4401763 PubMed 16167069