pUC19-gRNA
(Plasmid
#137776)
-
PurposeContains the T7 promoter and gRNA scaffold and is used for the in vitro transcription of gRNAs
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA scaffold
-
Insert Size (bp)125
-
MutationpUC19 BsaI destroyed
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggcggtaccaagctaatacgactcactataggggagaccgaggtctcgg
- 3′ sequencing primer attggatcctttaaaagcaccgactcggtgcca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-gRNA was a gift from Kabin Xie (Addgene plasmid # 137776 ; http://n2t.net/addgene:137776 ; RRID:Addgene_137776)
Map uploaded by the depositor.
