pAF302
(Plasmid
#137752)
-
PurposeIntracellular control plasmid for HiBiTopt experiments
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRPF185
-
Backbone manufacturerFagan and Fairweather
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 7566
-
Vector typeBacterial Expression
-
Selectable markersthiamphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehupA-linker-hibitopt
-
SpeciesClostridioides difficile
-
Insert Size (bp)366
-
GenBank IDYP_001090017.1
- Promoter Ptet
-
Tag
/ Fusion Protein
- HiBiTopt (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CACCTCCTTTTTGACTTTAAGCCTACGAATACC (NF793)
- 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG (NF794) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAF302 was a gift from Wiep Klaas Smits (Addgene plasmid # 137752 ; http://n2t.net/addgene:137752 ; RRID:Addgene_137752) -
For your References section:
The C-terminal domain of Clostridioides difficile TcdC is exposed on the bacterial cell surface. Oliveira Paiva AM, de Jong L, Friggen AH, Smits WK, Corver J. J Bacteriol. 2020 Aug 31. pii: JB.00771-19. doi: 10.1128/JB.00771-19. 10.1128/JB.00771-19 PubMed 32868401