LentiGuide-Puro-P2A-EGFP_mRFPstuf
(Plasmid #137730)

• Purpose: (Empty Backbone) Expresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNA
• Depositing Lab: Fredrik Wermeling
• Publication: Panda et al Proc Natl Acad Sci U S A. 2020 Jan 24. pii: 1914186117. doi: 10.1073/pnas.1914186117.

Backbone

• Vector backbone: lentiGuide-Puro-P2A-EGFP
• Backbone manufacturer: Feng Zhang Lab
• Backbone size (bp): 10963
• Modifications to backbone: A monomeric red fluorescent protein (mRFP) sequence driven by the lac promoter was cloned into the stuffer region of the lentiGuide-Puro-P2A-EGFP vector (#137729). Furthermore, a unique EcoRI site was introduced following the sgRNA scaffold.
• Vector type: Mammalian Expression, Bacterial Expression, Mouse Targeting, Lentiviral, CRISPR, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Best to use 32°C for sgRNA library cloning into the linearized vector
• Copy number: Unknown

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG
• 3′ sequencing primer: CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original lentiGuide-Puro plasmid (#52963) was obtained from Addgene.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

LentiGuide-Puro-P2A-GFP_mRFPstuf was generated from the lentiGuide-Puro-P2A-GFP (#137729), which was generated from lentiGuide-Puro (#52963).
The plasmid has mRFP driven by the bacterial lac promotor in the stuffer (the mRFP cassette was a kind gift from Dr. Erik Holmgren). The stuffer, 2839 bp, is excised by BsmBI digestion and replaced by a CRISPR library (or individual gRNA spacers). If the BsmBI digestion and the subsequent cloning is inadequate, the resulting CRISPR library can be contaminated by plasmids containing the stuffer instead of gRNAs. The bacterial mRFP cassette in the stuffer enables rapid identification of bacterial colonies carrying plasmids with retained stuffer (bacteria are red) and colonies without the stuffer (bacteria are white). This can be used as a simple visual quality control step for the gRNA cloning efficiency, as well as guide the selection of bacterial colonies where the stuffer has been excised.
A unique EcoRI site was introduced directly following the sgRNA scaffold, facilitating cloning in this region (introducing UMIs, introducing mutations in the sgRNA scaffold, etc).
The plasmid contains both PuroR and EGFP, enabling the selection of successfully infected cells based on both these selection markers. We typically add a pre-determined dose of puromycin (~5-15ug/ml) 24h after infection, using non-infected cells as controls for the efficiency of the selection. After 24-48h selection all non-infected control cells are typically dead, and the infected cells are ~100% EGFP positive. The EGFP signal can also be used for the simple determination of MOI of the viral preparation.
The provided sequencing primers are the primers traditionally used for NGS sequencing of gRNA representation in lentiGuide-Puro (#52963). This primer pair can also be used for Sanger sequencing the insert, amplifying the DNA sample (60oC annealing temp), and sequencing the ~300bp amplicon using the reversed primer. The forward primer is too close to the gRNA sequence for Sanger sequence. 5’-TGTAAACACAAAGATATTAGTACAAAATACGTGAC-3´ can be used as an alternative forward primer, resulting in a larger amplicon, better suited for Sanger sequencing.

LentiGuide-Puro-P2A-GFP_mRFPstuf vector was generated from the lentiGuide-Puro-P2A-GFP vector (#137729). This construct has RFP driven by a bacterial promotor in the stuffer (a kind gift from Dr. Erik Holmgren).