LentiGuide Puro-P2A-EGFP
(Plasmid #137729)

• Purpose: (Empty Backbone) For simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).
• Depositing Lab: Fredrik Wermeling
• Publication: Panda et al Proc Natl Acad Sci U S A. 2020 Jan 24. pii: 1914186117. doi: 10.1073/pnas.1914186117.

Backbone

• Vector backbone: lentiGuide-Puro (Plasmid #52963)
• Backbone manufacturer: Feng Zhang Lab
• Backbone size (bp): 10183
• Modifications to backbone: Mammalian codon-optimized EGFP sequence is cloned by the P2A linker into the C-terminal end of puromycin cassette driven by EF-1a promoter of the lentiGuide-Puro vector
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral, CRISPR, Synthetic Biology
• Selectable markers: Puromycin
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT (hU6-F)
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA (WPRE-R)

Resource Information

• Supplemental Documents:
  • LentiGuide Puro-P2A-EGFP.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: The original lentiGuide-Puro plasmid (#52963) was obtained from Addgene.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry