pCW57-mCherry-2A-BRD4 Iso AdelCTD
(Plasmid #137722)

• Purpose: Doxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)
• Depositing Lab: Scott Floyd
• Publication: Edwards et al Cell Rep. 2020 Sep 22;32(12):108166. doi: 10.1016/j.celrep.2020.108166.

Backbone

• Vector backbone: pCW57-GFP-2A-MCS
• Backbone size w/o insert (bp): 8400
• Total vector size (bp): 10492
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Slow growing plasmid, may need to incubate for >1 day
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: BRD4 long isoform without its C-terminal, P-TEFb interacting domain
• Alt name: BRD4
• Alt name: isoform AdelCTD
• Species: H. sapiens (human)
• Mutation: Truncated at amino acid 1328
• GenBank ID: NM_058243.2 NP_490597.1
• Entrez Gene: BRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
• Promoter: Tight TRE promoter
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTGGGACGAGATTGAGAAATCTG
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Resource Information

• Supplemental Documents:
  • Snapgene file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry