Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57-mCherry-2A-BRD4 Iso AdelCTD
(Plasmid #137722)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137722 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57-GFP-2A-MCS
  • Backbone size w/o insert (bp) 8400
  • Total vector size (bp) 10492
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Slow growing plasmid, may need to incubate for >1 day
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    BRD4 long isoform without its C-terminal, P-TEFb interacting domain
  • Alt name
    BRD4
  • Alt name
    isoform AdelCTD
  • Species
    H. sapiens (human)
  • Mutation
    Truncated at amino acid 1328
  • GenBank ID
    NM_058243.2 NP_490597.1
  • Entrez Gene
    BRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
  • Promoter Tight TRE promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTGGGACGAGATTGAGAAATCTG
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-mCherry-2A-BRD4 Iso AdelCTD was a gift from Scott Floyd (Addgene plasmid # 137722 ; http://n2t.net/addgene:137722 ; RRID:Addgene_137722)
  • For your References section:

    BRD4 Prevents R-Loop Formation and Transcription-Replication Conflicts by Ensuring Efficient Transcription Elongation. Edwards DS, Maganti R, Tanksley JP, Luo J, Park JJH, Balkanska-Sinclair E, Ling J, Floyd SR. Cell Rep. 2020 Sep 22;32(12):108166. doi: 10.1016/j.celrep.2020.108166. 10.1016/j.celrep.2020.108166 PubMed 32966794