pTE2690
(Plasmid #137717)

• Purpose: Expresses dimpLbCas12a-SunTag in mammalian cells.
• Depositing Lab: Ervin Welker
• Publication: Toth et al Nucleic Acids Res. 2020 Feb 28. pii: 5763098. doi: 10.1093/nar/gkaa110.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 4410
• Total vector size (bp): 10027
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dimpLbCas12a
• Alt name: human codon optimized inactive Lachnospiraceae bacterium Cas12a nuclease
• Insert Size (bp): 3684
• Mutation: D156R, G532R, K538V, Y542R, K595R, D832A,
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLSx3 SV40 (N terminal on insert)
  • SunTagx10 (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry