pTE3987
(Plasmid
#137716)
-
PurposeExpresses dLbCas12a-RVRR-BE in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 8166
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedLbCas12a-RVRR-BE
-
Alt nameinactive Lachnospiraceae bacterium Cas12a nuclease RVRR variant in fusion with Apobec base editor
-
Insert Size (bp)4767
-
MutationG532A, K538V, Y542R, K595R
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- APOBEC-1 (N terminal on insert)
- SV40 NLS (C terminal on insert)
- UGI (C terminal on insert)
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE3987 was a gift from Ervin Welker (Addgene plasmid # 137716 ; http://n2t.net/addgene:137716 ; RRID:Addgene_137716) -
For your References section:
Improved LbCas12a variants with altered PAM specificities further broaden the genome targeting range of Cas12a nucleases. Toth E, Varga E, Kulcsar PI, Kocsis-Jutka V, Krausz SL, Nyeste A, Welker Z, Huszar K, Ligeti Z, Talas A, Welker E. Nucleic Acids Res. 2020 Feb 28. pii: 5763098. doi: 10.1093/nar/gkaa110. 10.1093/nar/gkaa110 PubMed 32107556