Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ppwd1.473.646.W601A
(Plasmid #137660)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137660 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28a-LIC
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ppwd1
  • Species
    H. sapiens (human)
  • Mutation
    473-646-W601A
  • Entrez Gene
    PPWD1 (a.k.a. KIAA0073)
  • Tag / Fusion Protein
    • (His)6-thrombin (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7F and LIC primer: gtagtaccaacgcctgcgcttgataataagcataca
  • 3′ sequencing primer T7R and LIC primer: tgtatgcttattatcaagcgcaggcgttggtactaccgttatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MGSSHHHHHHSSGLVPRGSPSKEEVMAATQAEGPKRVSDSAIIHTSMGDIHTKLFPVECPKTVENFCVHSRNGYYNGHTFHRIIKGFMIQTGDPTGTGMGGESIWGGEFEDEFHSTLRHDRPYTLSMANAGSNTNGSQFFITVVPTPaLDNKHTVFGRVTKGMEVVQRISNVKVNPKTDKPYEDVSIINITVK

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ppwd1.473.646.W601A was a gift from Tara Davis & Melissa Jurica (Addgene plasmid # 137660 ; http://n2t.net/addgene:137660 ; RRID:Addgene_137660)
  • For your References section:

    Nuclear cyclophilins affect spliceosome assembly and function in vitro. Adams BM, Coates MN, Jackson SR, Jurica MS, Davis TL. Biochem J. 2015 Jul 15;469(2):223-33. doi: 10.1042/BJ20150396. Epub 2015 May 13. 10.1042/BJ20150396 PubMed 25967372